Bisulfite - PDFSEARCH.IO - Document Search Engine

Bisulfite
Results: 194

#	Item
81	Executive Summary This application is made on behalf of the New Zealand abalone industry, to include sodium hydrosulphite (also known as sodium dithionite) as a permitted food additive for use in canned abalone (paua) as Add to Reading List Source URL: www.foodstandards.gov.au Language: English - Date: 2013-07-24 01:40:21 Chemical elements Sodium compounds Abalone Haliotidae Food additives Sodium bisulfite Sulfite Pāua Sulfur Chemistry Matter Dietary minerals
82	SIMPLE TIPS TO BOOST YOUR BISULFITE-BASED APPLICATIONS This piece is brought to you by Zymo Research scientists, Lam Nguyen and Ron Leavitt. Bisulfite conversion remains a key player in almost every study involving DNA m Add to Reading List Source URL: www.zymoresearch.de Language: English - Date: 2013-10-04 14:25:51 Genetics Polymerase chain reaction Epigenetics Laboratory techniques Biotechnology Bisulfite sequencing Primer DNA methylation Zymo Research Biology Molecular biology Biochemistry
83	ZYMO RESEARCH The Beauty of Science is to Make Things Simple Peanuts A Biotechnical Newsletter Add to Reading List Source URL: www.zymoresearch.de Language: English - Date: 2012-07-02 17:45:58 Genetics Zymo Research Polymerase chain reaction DNA methylation DNA sequencing Sodium bisulfite DNA Gel electrophoresis Plasmid preparation Biology Molecular biology Chemistry
84	United States Environmental Protection Agency Office of Water Washington, D.C. Add to Reading List Source URL: www.epa.gov Language: English - Date: 2000-11-01 12:55:10 Water treatment Food additives Chemical elements Oxidizing agents Sodium bisulfite Chlorination Chlorine Chloramine Sulfur dioxide Chemistry Matter Sodium compounds
85	BSpipe.Window.Methylation Documentation Description: Measures methylation across windows in samples mapped by BSpipe Author: GHSU COMICS BSpipe Ve Add to Reading List Source URL: www.broadinstitute.org Language: English FASTA format Methylation Configuration file Bisulfite sequencing Epigenetics Biology Chemistry
86	Additional file 1 – Primers and PCR condition for bisulfite genomic sequencing Gene PCR product Primer name Primer sequence PCR condition Product size Aicda 　 meAicda-F1-S GTGGTATTTGGGTTGGTTTTTTAGAGGAAT 94℃,1 min. Add to Reading List Source URL: www.biomedcentral.com Language: English Molecular biology Science Laboratory techniques Amplifiers Hoffmann-La Roche Biology Chemistry Polymerase chain reaction
87	ARTICLES Targeted bisulfite sequencing reveals changes in DNA methylation associated with nuclear reprogramming © 2009 Nature America, Inc. All rights reserved. Add to Reading List Source URL: genome-tech.ucsd.edu Language: English - Date: 2009-08-10 21:55:53 Molecular biology DNA Genomics Bisulfite sequencing Methylated DNA immunoprecipitation Epigenomics DNA methylation Methylation CpG site Genetics Biology Epigenetics
88	Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 2012, Article ID[removed], 8 pages doi:[removed][removed]Methodology Report Add to Reading List Source URL: downloads.hindawi.com Language: English - Date: 2014-05-08 07:51:18 Epigenetics DNA sequencing Genomics DNA Bisulfite sequencing Epigenomics RNA-Seq Polymerase chain reaction FASTQ format Biology Genetics Molecular biology
89	Tournier et al. BMC Cancer 2012, 12:12 http://www.biomedcentral.com[removed]RESEARCH ARTICLE Open Access Add to Reading List Source URL: www.biomedcentral.com Language: English Molecular biology Epigenetics DNA Genomics Biotechnology Bisulfite sequencing DNA methylation Polymerase chain reaction Methylation Biology Genetics Chemistry
90	Archived at the Flinders Academic Commons: http://dspace.flinders.edu.au/dspace/ This is the publisher’s copyrighted version of this article. The original can be found at: http://www.molecular-cancer.com/content[removed] Add to Reading List Source URL: dspace.flinders.edu.au Language: English - Date: 2014-11-05 23:11:57 Chemistry DNA Molecular biology Molecular genetics Genomics Combined bisulfite restriction analysis DNA methylation Bisulfite sequencing Methylation Biology Genetics Epigenetics

UPDATE