| Document Date: 2009-01-27 16:27:12 Open Document File Size: 744,42 KBShare Result on Facebook
City Palo Alto / / Company Intel / Digital Equipment Corporation / / Facility University of Maryland / College Park / / IndustryTerm block sorting lossless data compression algorithm / normal search / above algorithm / open source software / quality-aware backtracking algorithm / alignment tools / search algorithm / depth-first search / mirrored search / / Organization Steven L. Salzberg Center for Bioinformatics and Computation Biology / University of Maryland / College Park / IEEE Computer Society / / Person Cole Trapnell / Ben Langmead / / Technology above algorithm / acctagattcagaggtcaccataggcacatgcag Bowtie Search Algorithm / RAM / Bioinformatics / search algorithm / block sorting lossless data compression algorithm / human genome / quality-aware backtracking algorithm / / URL http /
SocialTag |