| Document Date: 2012-04-27 14:08:08
Open Document File Size: 1,11 MBShare Result on Facebook
Company GTGATGATGGTGAAGGTCTTGG AG / T. / National Renewable Energy Laboratory / EGL / Creative Commons / BioMed Central Ltd. / Target Genbank / / Country United States / / / IndustryTerm yellow poplar chips / composted poplar chips / chemical analysis procedures / thermo-chemical feedstock pretreatment / yellow poplar wood chips / Microscopic imaging / composted yellow poplar chips / kitchen food wastes / cellulolytic enzyme systems / herbaceous energy crops / woody energy crops / biomass conversion technology / industrial cellulase producer / biomass-derived biotechnology / chemical compositional analysis / energy crops / chemicals / biomass-to-biofuels conversion technology / food waste / / Person Hui Wei / Gala Arabi Subtotal / Michael Himmel / Melvin Tucker / John Baker / Michelle Harris / / Position industrial cellulase producer / representative / common calibrator / common producer / / ProvinceOrState Colorado / / Technology biomass-to-biofuels conversion technology / composted yellow poplar chips / genetic engineering / yellow poplar wood chips / composted poplar chips / Biotechnology / HTML / SSL / PDF / Biofuels / gene expression / composting / yellow poplar chips / bioprocessing / biomass conversion technology / / URL http /
SocialTag |
Biotechnology for Biofuels This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Tracking dynamics of plant biomass