Complementarity

Results: 296



#Item
81NOAA Office of Ocean Exploration and Research Ocean Sampling Day - TransAtlantic Ocean Science and Ocean Literacy Complementarity – Online Workshop May 2015 Graduate Credit Requirements FIRST REGISTER WITH ASHLAND UNIV

NOAA Office of Ocean Exploration and Research Ocean Sampling Day - TransAtlantic Ocean Science and Ocean Literacy Complementarity – Online Workshop May 2015 Graduate Credit Requirements FIRST REGISTER WITH ASHLAND UNIV

Add to Reading List

Source URL: www.coexploration.org

Language: English - Date: 2015-04-30 12:54:07
8216 observations on the uncertain Krystal South

16 observations on the uncertain Krystal South

Add to Reading List

Source URL: krystalsouth.com

Language: English - Date: 2011-09-18 21:00:41
83Financial Liberalization, Capital-skill Complementarity, and Wage Inequality∗ Mauricio Larrain† University of California, Berkeley Job Market Paper First Draft: November, 2011

Financial Liberalization, Capital-skill Complementarity, and Wage Inequality∗ Mauricio Larrain† University of California, Berkeley Job Market Paper First Draft: November, 2011

Add to Reading List

Source URL: ceg.berkeley.edu

Language: English - Date: 2012-02-01 16:24:11
84Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and

Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and

Add to Reading List

Source URL: rw.mammoth.psu.edu

Language: English - Date: 2008-12-01 13:55:23
85Geometry and equilibria in bimatrix games Anne Verena Balthasar A thesis submitted for the degree of Doctor of Philosophy

Geometry and equilibria in bimatrix games Anne Verena Balthasar A thesis submitted for the degree of Doctor of Philosophy

Add to Reading List

Source URL: www.maths.lse.ac.uk

Language: English - Date: 2009-09-26 13:41:12
86Computation Reuse for Rigid-body Dynamics竄ｬ

Computation Reuse for Rigid-body Dynamics竄ｬ

Add to Reading List

Source URL: www.ists.dartmouth.edu

Language: English - Date: 2008-09-11 13:40:06
87When quantum mechanics and international relations collide

When quantum mechanics and international relations collide

Add to Reading List

Source URL: phys.org

Language: English - Date: 2015-05-27 15:46:04
88Journal of Scienti® c Exploration, Vol. 12, No. 4, pp. 543±550, 98 € 1998 Society for Scienti® c Exploration A Double-Slit Diffraction Experiment to Investigate Claims of

Journal of Scienti® c Exploration, Vol. 12, No. 4, pp. 543±550, 98 € 1998 Society for Scienti® c Exploration A Double-Slit Diffraction Experiment to Investigate Claims of

Add to Reading List

Source URL: www.princeton.edu

Language: English - Date: 2010-11-03 02:50:43
89Unintended Positive Complementarity: Why International Criminal Court Investigations Increase Domestic Human Rights Prosecutions∗ Geoff Dancy† Tulane University

Unintended Positive Complementarity: Why International Criminal Court Investigations Increase Domestic Human Rights Prosecutions∗ Geoff Dancy† Tulane University

Add to Reading List

Source URL: tulane.edu

Language: English - Date: 2015-01-20 12:21:57
90Integrating the TDBU-ETSAP models in MCP format ETSAP Workshop on “Economic impacts of hybrid energy-economy models” Copenhagen, Denmark, 19th of November, 2014 E. Panos and S. Kypreos, PSI

Integrating the TDBU-ETSAP models in MCP format ETSAP Workshop on “Economic impacts of hybrid energy-economy models” Copenhagen, Denmark, 19th of November, 2014 E. Panos and S. Kypreos, PSI

Add to Reading List

Source URL: www.iea-etsap.org

Language: English - Date: 2014-12-17 00:57:36