View Document Preview and Link Document Date: 2014-10-22 21:01:37 Open Document File Size: 253,53 KB Share Result on Facebook
City Morosini / Dublin / Madrid / Bangui / Cork / a PCR / Paris / Tunis / Toronto / Livermore / Wellington / / Company aph2R CACACTATCATAACCATCACCG AG / E. faecium AG / Enterobacteriaceae / Matsushita / ESBL / Axis Shield / Lerner SA / Sigma Aldrich / Proc Natl Acad Sci U S A / Bernstein / Google / Qiagen / Beckman Coulter / Bifunctional AG / BioMed Central Ltd. / Kotra LP / Creative Commons / / Continent Europe / / Country Germany / United States / Canada / United Kingdom / South Korea / Ireland / / / Event Diplomatic Relations / / Facility PDC laboratory / Smalla laboratory / University College Cork / Hall RM / Pharmabiotic Centre / Alimentary Pharmabiotic Centre / / IndustryTerm amplification products / extraction protocol / online submission / / MedicalCondition Pseudomonas / nosocomial infections / infections / gastrointestinal disorders / Enterobacteriaceae infections / epidemic phage types / N-acetyltransferase Pseudomonas / aminoglycoside-resistant Enterococcus faecium bacteremia / S. aureus / antibiotic resistant infections / / MedicalTreatment antibiotics / chemotherapy / / Organization Teagasc Food Research Centre / BlaROB YP / Ethics Committee of the Cork Teaching Hospitals / Alimentary Pharmabiotic Centre / Science Foundation Ireland / 3Alimentary Pharmabiotic Centre / Single Hospital / Proteobacteria / Centre for Disease Control / Irish Government / / Person Brian Jones / Lesley Ogilvie / Knox JR / Silva Lopes / Fiona Fouhy / Gill SR / / Position Investigator / Muller MP / Francino MP / Hawkey PM / author / King / Tulkens PM / Mingeot-Leclercq MP / / Product 5e-106 99 AAX82584.1 WP / kanamycin / penicillin / Sardius m36 / Gentamicin / ampicillin / tobramycin / cefotaxime / ciprofloxacin / / ProvinceOrState Sussex / / PublishedMedium PLoS ONE / / RadioStation Hujer AM / Voskresenskiy AM / / Region Southern Europe / Western Europe / / Technology wastewater treatment / Cloning / 314 chip / DNA sequencing / metagenomic DNA extraction protocol / chemotherapy / Gel electrophoresis / / URL http / SocialTag 
In Silico identification of pathogenic strains of Cronobacter from Biochemical data reveals association of inositol fermentation with pathogenicity