![Polymerase chain reaction / Primer / Pseudomonas aeruginosa / FASTA / Multiple displacement amplification / Variants of PCR / Biology / Molecular biology / Biochemistry Polymerase chain reaction / Primer / Pseudomonas aeruginosa / FASTA / Multiple displacement amplification / Variants of PCR / Biology / Molecular biology / Biochemistry](https://www.pdfsearch.io/img/b20eb495ca1f085bfcc88845980588cd.jpg)
| Document Date: 2013-06-03 15:12:30 Open Document File Size: 91,31 KBShare Result on Facebook
/ IndustryTerm extract solution / extraction protocol / / Position GGATTCTCTCGCACGAGGT TACGTGACCTGACGTTGGTG ms217.forward / curator / ms172.forward / / Technology aeruginosa The DNA extraction protocol / 05.13 DSLT protocol / ms217 loci This PCR protocol / 04/2013 DSLT protocol / / URL www.dlst.org / /
SocialTag |