![Orders of insects / Ketones / Plant hormones / Lepidoptera / Spodoptera / Beet armyworm / Caterpillar / Plant defense against herbivory / Noctuidae / Phyla / Protostome / Biology Orders of insects / Ketones / Plant hormones / Lepidoptera / Spodoptera / Beet armyworm / Caterpillar / Plant defense against herbivory / Noctuidae / Phyla / Protostome / Biology](https://www.pdfsearch.io/img/15869ac690738263e073783a496a3586.jpg)
| Open Document File Size: 602,63 KBShare Result on Facebook
City Tokyo / Deerfield / Coralville / NanoDrop™ Spectrophotometer / Bradford / St. Louis / / Company Reverse TGATTAACAATTTTTTTCTGTGATGTT Forward CAAGGAGTATGTTAATGTCAGG Reverse GCTTCATATAAGTTCAATATTCC GenBank / Alltech Associates / Zebelo SA / Agilent Technologies / Quanta Biosciences Inc / BioMed Central Ltd. / Olympus / Sigma Aldrich / Suzuki / Creative Commons / / Country Japan / United States / / / Facility plant VOCs / National Institute of Standards and Technology / Plant Pathology / Methods Plant / Auburn University / / IndustryTerm mass spectral search software / stainless steel / stainless steel pin / food substrate / plant signaling networks / / MedicalCondition herbivore injury / mechanical injury / simple mechanical injury / injury / / Organization National Institute of Standards and Technology / Auburn University / US Federal Reserve / Department of Entomology & Plant Pathology / / Person Simon Zebelo / Heather Leyva / Jill Piorkowski / Joseph Disi / VEGI VEGA / / Position caterpillar head / RT / representative / / / ProgrammingLanguage J / / ProvinceOrState Alabama / Colorado / / PublishedMedium Plant Pathology / / Technology gene expression / http / simulation / gel electrophoresis / pheromones / / URL http /
SocialTag |