View Document Preview and Link Open Document File Size: 1,64 MB Share Result on Facebook
City Carlsbad / Hercules / Madison / Memphis / Cambridge / Indianapolis / Foster City / Lyon / Oakland / / Company Roche Diagnostics / Google / Figure 1 Group / Bio-Rad Laboratories / Creative Commons / BACPAC Resources / BioMed Central Ltd. / I Gupta / / Country France / United States / Australia / / Currency pence / / / Facility Women’s Hospital / Jude Children’s Research Hospital / / IndustryTerm reticulin-rich fibrous network / magnetic resonance imaging / fusion product / diffusion-weighted imaging / online submission / sequence analysis software version / screened using CLC Main Workbench sequence analysis software version / / MedicalCondition Discussion Gangliogliomas / rare low-grade neuroepithelial tumors / Mutation Background Gangliogliomas / pediatric low-grade gliomas / several tumors / posterior fossa pilocytic astrocytomas / classic supratentorial tumor / chronic intractable focal epilepsy / Gangliogliomas / largely pilocytic astrocytomas / cysts / pediatric gangliogliomas / glioma / vermian tumors / classic pilocytic astrocytoma / neoplastic ganglion / posterior fossa tumors / cerebellar ganglioglioma / II tumor / Pediatric infratentorial gangliogliomas / dysmorphic ganglion / few ganglion / supratentorial tumors / Gangliocytoma / Posterior cranial fossa gangliogliomas / often circumscribed tumors / low-grade glioneuronal tumors / I - classic ganglioglioma Tumors / infratentorial tumors / ganglioglioma n/a Page / tumor / reverse CCTGGAGATTTCTGTAAGGCTTTC ganglion / focal epilepsies / ganglioglioma and extra-cerebellar pilocytic astrocytoma / necrosis / II tumors / II - pilocytic astrocytoma / rare mixed glioneuronal tumors / Cancer / dysembryoplastic neuroepithelial tumor / classic gangliogliomas / tumors / pilocytic astrocytoma / low-grade astrocytomas / classic ganglioglioma / adult-type disease / I tumor / tumor BRAF / II diffuse astrocytomas / tumour / chronic intractable epilepsy / ganglion / few dysmorphic ganglion / infratentorial gangliogliomas / low-grade neuroepithelial tumors / Pontomedullary ganglioglioma / pilocytic astrocytomas / rosette-forming glioneuronal tumor / II contained tumors / typical cerebral gangliogliomas / neuroepithelial tumors / BRAF V600E duplication Neuroimaging KIAA1549-BRAF fusion gene Midline location Circumscribed No No Cysts/ Hemorrhage Enhancement Edema necrosis / Posterior fossa gangliogliomas / Another rare glioneuronal tumor / glioneuronal tumor / spinal gangliogliomas / only three tumors / certain tumors / Central nervous system gangliogliomas / nervous system tumors / pediatric ganglioglioma / few infratentorial low-grade glioneuronal tumors / glioneuronal tumors / pediatric low-grade astrocytomas / commonest tumor / I tumors / Ganglioglioma / Spinal cord gangliogliomas / CNS tumors / / MedicalTreatment Neurosurgery / / Organization World Health Organization / Department of Pathology / St. Jude Children’s Research Hospital / Royal Brisbane and Women’s Hospital / St. Jude Children's Research Hospital Institutional Review Board / International Agency for Research / / Person Charlene Henry / Ying Yuan / GGGTCCCCAGTAAGATCCAG ATCGCCATGCAGCCGATCCCGGCACCT / / Position author / forward / reporter / / Product triad / / ProvinceOrState Tennessee / Pennsylvania / / PublishedMedium PLoS One / / Technology Antibodies / hybridization / MRI / magnetic resonance imaging / Neurosurgery / / URL www.biomedcentral.com/submit / http / SocialTag 
Acta_Neuropathologica_Communications_Logo_Draft_02