Back to Results
First PageMeta Content
Herpesviruses / Herpes / Viral diseases / Animal virology / Corneal transplantation / Eye surgery / Cornea / Canine herpesvirus / Herpetic keratoconjunctivitis / Medicine / Health / Ophthalmology


Establishment and Characterization of an Air-Liquid Canine Corneal Organ Culture Model To Study Acute Herpes Keratitis Rebecca M. Harman,a Leen Bussche,a Eric C. Ledbetter,b Gerlinde R. Van de Wallea Baker Institute for
Add to Reading List

Document Date: 2014-12-09 11:10:00

Open Document

File Size: 1,59 MB

Share Result on Facebook

City

Santa Clara / Valley / Philadelphia / West Chester / Portsmouth / Concord / Delmont / Ames / Springfield / Waltham / San Jose / Carpinteria / Valencia / Ithaca / Vineland / Cambridge / Manassas / /

Company

Bellco Glass Inc. / Life Technologies / Staats HF / Thermo Fisher Scientific / Sigma-Aldrich / Agilent / Qiagen / Pullman / BD Biosciences / Corning / IgG / Feature Extraction Software / Olympus / GE / Edelhauser HF / /

Country

Germany / /

/

Facility

College of Veterinary Medicine / Cornell University Library / Center Valley / Baker Institute / Scale bar / Gerlinde R. Van de Wallea Baker Institute / Cornell Center / Cornell University / /

IndustryTerm

collected culture media / culture media / imaging / in vitro corneal epithelial cell culture systems / investigative tool / human corneal organ culture systems / agarose solution / in vivo systems / /

MedicalCondition

JE / Air-Liquid Canine Corneal Organ Culture Model To Study Acute Herpes Keratitis Rebecca M. Harman / severe medical disorders / Herpes simplex keratitis / herpetic stromal keratitis / ocular herpesvirus infections / ocular disease / murine herpetic stromal keratitis / keratitis / recurrent eye diseases / HSV keratitis / ocular diseases / viral infections / recrudescent keratitis / acute ocular herpesvirus infection / retinal dysplasia / Infection / herpes simplex virus / corneal infection / DF / herpesvirus-induced ocular disease / infectious cause / herpes / conjunctivitis / noninfectious and infectious ocular diseases / lphaherpesvirus infection / infections / blindness / primary and recurrent infections / alphaherpesvirus infection / corneal HSV infection / disease / primary ocular infection / acute corneal infection / PFA / disease virus / ocular herpesvirus infection / Herpes Keratitis / infectious diseases / ocular herpes / Human herpes simplex virus keratitis / acute ocular infection / dehydration / /

MedicalTreatment

antibody therapy / /

Organization

American Society for Microbiology / Institute for Animal Healtha / Cornell University / Cornell Diagnostic Center / Cornell Center for Materials Research / College of Veterinary Medicine / National Science Foundation / Department of Clinical Sciences / Baker Institute for Animal Health / /

Person

Lynn Anguish / Rebecca M. Harman / Edward Thompson / Michelle Edelman / David Vanderpoorten / Julie Jordan / Charles C. Thomas / Virol / Reverse Amplicon / Gene Harman / R. Van de Walle / /

Position

RT / Abbreviation Function Forward / Collin HB / General / model for studies on ocular herpesvirus infections / Representative / organ culture model for corneal wound healing and corneal transplantation / Editor / Howley PM / natural host model for alphaherpesvirus pathogenesis / /

Product

IL-8 CACTCCACACCTTTCCATCC / Sigma / penicillin / Vizio L32 Television / IL-1 / /

ProvinceOrState

New York / Illinois / Pennsylvania / /

PublishedMedium

Lippincott Williams & Wilkins / Journal of Virology / /

Technology

digital camera / apoptosis / WAP / DNA Chip / gene expression / tomography / antibodies / hybridization / transplantation / http / /

URL

http /

SocialTag