Back to Results
First PageMeta Content
Emerging technologies / Molecular biology / Bioethics / Synthetic biology / Biosecurity / Artificial gene synthesis / Oligonucleotide / Bio-Synthesis / Inc. / Integrated DNA Technologies / Biology / Biotechnology / Molecular genetics


Document Date: 2011-11-30 09:08:52

Open Document

File Size: 372,03 KB

Share Result on Facebook

City

Munich / /

Company

Blackwatch19 / Bayer / Markus Fischer Entelechon GmbH / Biosynthetics GmbH / Sloning Biotechnology GmbH / Genbank / Biomax Informatics AG / Life Sciences Damon Terrill Integrated DNA Technologies Inc. / Holding GmbH / MWG Biotech AG / IDT / Page 9 Government Select Agent List ATGCACAGGACAGATTAGACAC / Entelechon GmbH / Public Policy Werner Deininger Entelechon GmbH / /

Continent

Europe / /

Country

Germany / United States / Australia / United Kingdom / /

Facility

Public Policy Kathryn Nixdorff Universität Darmstadt Catherine Rhodes University / Fraunhofer Institute / /

IndustryTerm

homology search / biotechnology / transportation systems / niche technology / biotechnological applications / biological systems / nuclear energy / human and agricultural health systems / gene synthesis services / exhaustive infrastructure / biotechnology developments / genetic networks / de novo solutions / electronics / generation technologies / /

OperatingSystem

LINUX / /

Organization

Drew University / World Health Organization / U.S. Central Intelligence Agency / US government / Goldman School / Royal Academy / Fraunhofer Institute for Systems and Innovation Research / Federal Bureau of Investigation / School of Public Policy Werner Deininger Entelechon GmbH Markus Fischer Entelechon GmbH Sibylle Gaisser TESSY Marcus Graf GeneArt Philipp Habermeier Febit Gudrun Horn Sloning Robert Jones Craic Computing LLC Stephanie Kretz Europäische Union Josef Maier IStLS / Industry Association Synthetic Biology / Bradford Maxim Scheremetjew Universität Halle-Wittenberg Heinz Schwer Sloning Peer Stähler Febit Eva Sterzel Febit Karoline Stürmer Geneart AG Terence Taylor International Council for the Life Sciences Damon Terrill Integrated DNA Technologies / U.S. National Intelligence Council / Policy Coordinating Committee / University of Bradford / FDA / American National Academy of Sciences / Security Council / European Union / International Consortium for Polynucleotide Synthesis / National Science Advisory Board on Biosecurity / Rhodes University / /

Person

Sibylle Gaisser / Anna Zmorzynska Universität Hamburg / Bradford Maxim Scheremetjew Universität / Robert Jones / Matthew Meselson / Stephen Maurer / Klaus Heumann / Anthony Caruso Febit Jason Christopher / Tobias Wagner Eurofins / Craig Venter / Marcus Graf / Steve Maurer / Werner Deininger / Heinz Schwer Sloning Peer Stähler / Philip Habermeier / Heinz Schwer / Philipp Habermeier Febit / Alexandra Beil Sloning Hubert Bernauer / Tobias Wagner / Stephanie Kretz / Damon Terrill / Jason Christopher / Luis Campos / Hubert Bernauer / Josef Maier / Markus Fischer / /

Position

representative / leading molecular biologist / Molecular biologist / /

Technology

generation technologies / genetic engineering / Linux / biotechnology / ATG / second generation technologies / drug discovery / niche technology / recombinant DNA / /

URL

www.ia-sb.eu / /

SocialTag