Interferon regulatory factors

Interferon regulatory factors
Results: 3

#	Item
1	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
2	The EMBO Journal[removed], 4571–4585 www.embojournal.org \|&[removed]European Molecular Biology Organization \| All Rights Reserved[removed] Add to Reading List Source URL: emboj.embopress.org Language: English - Date: 2015-03-03 11:29:46 Biochemistry IRF6 Notch signaling pathway Interferon regulatory factors Small interfering RNA NUMB Gene expression Notch-1 Biology Transcription factors Genetics
3	Systemic remodeling of the redox regulatory network due to RNAi perturbations of glutaredoxin 1, thioredoxin 1, and glucose-6-phosphate dehydrogenase Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Transcription factors Genetics Gene delivery Transfection Gene expression IRF1 Functional genomics Gene Interferon regulatory factors Biology Molecular biology Biochemistry

UPDATE