KAIBAB PLATEAU / Valencia / Sunderland / Oxford / Philadelphia / VOLO ET / natal / Nottingham / San Diego / Kaibab / /
Company
Sudbury / Fort Collins CO. Laboratory / ACKNOWLEDGMENTS Laboratory / Blackwell Science Ltd. / Sinauer Associates Inc. / Jones / Raptor Research Foundation Inc. / UT U.S.A. S.L. / Bartlett Publishers Inc. / Birds of North America Inc. / Cambrex Corp. / U.K. SONSTHAGEN S.A. / Qiagen Inc. / Promega Corp. / Aquila / /
Country
United States / United Kingdom / / /
Event
Environmental Issue / FDA Phase / Extinction / /
Facility
Colorado State University / Meyer Hall / REYNOLDS Rocky Mountain Research Station / Rocky Mountain Research Station / Laboratory Methods / U.S.A. BERNIE MAY Genomic Variation Laboratory / AND B.S. WEIR / U.S.A. J. RICK TOPINKA Genomic Variation Laboratory / University of California / /
IndustryTerm
iterative algorithm / empirical applications / collection protocol / analytical software / population genetics software / mineral oil / /
NaturalFeature
Grand Canyon / Kaibab National Forest / /
Organization
Univ. of Nottingham / Department of Biology / USDA / USDA Forest Service / Brigham Young Univ. / Small Grant Research Fund / Colorado State University / University of California / Davis / U.S.A. BERNIE MAY Genomic Variation Laboratory / Raptor Research Foundation / Grand Canyon National Park Foundation / U.S.A. J. RICK TOPINKA Genomic Variation Laboratory / /
Person
SHELLEY BAYARD DE / S. KAMBHAMPATI / A.A. SNOW / John Keane / A. BAYARD DE VOLO / BAYARD MARKER / E. MATTHYSEN / S. VAN DONGEN / W.C. BLACK / IV / Reynolds / Mauricio Cotera / Bayard de Volo / M.F. ANTOLIN / PING FOR MARKRECAPTURE / S. Bayard de Volo / Brigham Young Univ / Joy / J. PIESMAN / C.F. BOSTO / D.F. WEST / MICHAEL F. ANTOLIN / /
Position
Editor / gentilis NAa SPECIES ALLELES HO HE H-Wb / Corresponding author / North Kaibab Ranger / cttcccggtggctgaggctt AUTHOR / Fisher / representative / Marshall / /
Population genetics and genotyping for mark-recapture studies of Northern Goshawks (Accipiter gentilis) on the Kaibab Plateau, Arizona