Back to Results
First PageMeta Content



Additional file 1 Table S1. Bovine oligonucleotide primers used for qPCR Gene Symbol Primers (5’ to 3’) Product[removed]size Efficiency1 Accession Number Nucleoside transporters SLC28A1 F: AGAAGTGAGGAAGGCGTGAA
Add to Reading List

Document Date: 2014-10-22 21:01:38


Open Document

File Size: 56,50 KB

Share Result on Facebook

time: 0.0017 sec.

Designed and built with all the love in the world in Europe.

© PDFSEARCH.IO 2013 Privacy | Contact Us