OpenWetWare

Results: 758



#Item
391Bacteriophages / Microbiology / T7 phage / Model organism / Developmental biology / Genomics / Drew Endy / Caenorhabditis elegans / Cell signaling / Biology / Systems biology / Synthetic biology

Programmed Development of Biological Organisms The development of natural biological organisms provides a stunning example of how noisy, genetically identical cells or viruses can achieve complex, deterministic outcomes.

Add to Reading List

Source URL: openwetware.org

Language: English - Date: 2006-11-20 01:10:01
392Chemistry / Green fluorescent protein / Reporter gene / Fluorescence microscope / Gene expression / Transcription / Lac operon / Microscopy / X-gal / Biology / Molecular biology / Biochemistry

Gemini, a Bifunctional Enzymatic and Fluorescent Reporter of Gene Expression Lance Martin1., Austin Che2.¤, Drew Endy1* 1 Department of Bioengineering, Stanford University, Stanford, California, United States of America

Add to Reading List

Source URL: www.openwetware.org

Language: English - Date: 2009-11-05 08:52:00
393Anatomical pathology / Neoplasm / Clone / Oxaliplatin / Cancer research / Metastasis / Medicine / Oncology / Immunology

Variable Clonal Repopulation Dynamics Influence Chemotherapy Response in Colorectal Cancer Antonija Kreso et al. Science 339, [removed]); DOI: [removed]science[removed]

Add to Reading List

Source URL: openwetware.org

Language: English - Date: 2013-02-25 20:09:06
394

AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAACAGCTTGCTGTTTCGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGG

Add to Reading List

Source URL: www.openwetware.org

Language: German - Date: 2013-03-05 17:10:26
    395Protein engineering / Proteins / Mutagenesis / Silent mutation / Biology / Genetics / Mutation

    M2D1: Design IPC Mutant[removed]Wednesday, March 13, 2013 Announcements

    Add to Reading List

    Source URL: openwetware.org

    Language: English - Date: 2013-03-13 14:09:40
    396

    PDF Document

    Add to Reading List

    Source URL: www.openwetware.org

    - Date: 2013-03-08 09:25:06
      397Frequency modulation

      M2D8: The Big Day II -- Analysis[removed]Lab Treat 2. Notebooks due today: M2D6 3. No lab on Wednesday -- OH discussion (doodle results -- be honest) 4. Module 2 Report:

      Add to Reading List

      Source URL: openwetware.org

      Language: English - Date: 2013-05-03 14:20:13
        398

        Protocol for Micropipet Calibration To calibrate your P1000, P 200, and P 20 micropipets, label 6 microfuge tubes[removed]and weigh them. Record the weights in the table below. Following the table below, pipet the specifi

        Add to Reading List

        Source URL: openwetware.org

        - Date: 2010-01-06 12:06:55
          399Sweeteners / Logistic map / Regression analysis / Fructose / Nutrition

          [removed]Bioprocess Modeling and Simulation Aman KumarBT10B003

          Add to Reading List

          Source URL: openwetware.org

          Language: English - Date: 2014-07-09 18:31:30
          400Type three secretion system / Ancient history / Sica / Salmonella / Microbiology / Biology / Organelles

          Presented  by  Paula  and  Natalie   Feb  20th,  2013   20.385   Nature  491,  249–253  (08  November  2012)  doi:[removed]nature11516   ApplicaHons  of  Layered

          Add to Reading List

          Source URL: openwetware.org

          Language: English - Date: 2013-02-20 15:38:30
          UPDATE