M2D2: Site-directed Mutagenesis[removed] • First module 2 quiz on Wednesday, FNT also due • Primer design summaries are also due Wednesday -- see wiki for all the information that you need

Source URL: openwetware.org

• Biotechnology
• Polymerase chain reaction
• Mutagenesis
• Site-directed mutagenesis
• Restriction enzyme
• Restriction site
• DPNI
• Biology
• Molecular biology
• Biochemistry

Name: Date: Project: H2O 10x  Buffer

Source URL: openwetware.org

ChIP-seq Sample Preparation and Sequencing Request Form Name:______________________________ Email address_________________________ Phone__________________ Date_________________ Lab Name_________________ Account # /

Source URL: openwetware.org

AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAACAGCTTGCTGTTTCGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGG

Source URL: openwetware.org

Nucleotide Sequence for Inverse Pericam Note: numbering refers to amino acid residues, not nucleotides. Note: this sequence is directly preceded by a BamHI site w/frame-shift, G GAT CCG[removed]AAG AGG CGC TGG AAG AAA AAC

Source URL: openwetware.org

Author Manuscript Published OnlineFirst on January 30, 2013; DOI:[removed].MCT[removed]Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Poly(beta-aminoester) n

Source URL: openwetware.org

• Molecular biology
• Tumor suppressor genes
• Lung cancer
• Protein methods
• P53
• Transfection
• Viral vector
• Green fluorescent protein
• Transformation
• Biology
• Biochemistry
• Gene delivery

Klebsiella oxytoca(TR-Blue-C4) Klebsiella oxytoca(TR-Blue-C5) Klebsiella oxytoca(TR-Blue-C6) Citrobacter murliniae strain(TR-Blue-C8) Klebsiella oxytoca(TR-Red-C7) Klebsiella oxytoca(TR-Red-C1)

Source URL: www.openwetware.org

OHSU BCMB Course Evaluation Circle each answer: 1) Overall organization great

Source URL: www.openwetware.org

Informed Consent - student copy – keep for your records VIII The Human Subjects Committee in the Biology Department requires documented informed consent when a student is involved as a subje

Source URL: www.openwetware.org

• Science
• Institutional Animal Care and Use Committee
• Medical research
• Animal welfare
• Informed consent
• Animal testing regulations
• Animal rights
• Animal testing
• Biology

THE UNIVERSITY OF TEXAS HEALTH SCIENCE CENTER - HOUSTON Language Development in Children Studied Using fMRI and NIRS HSC-MS[removed]PARENTAL CONSENT FOR CHILD TO JOIN A RESEARCH STUDY (ages 5 – 12) Principal Investigat

Source URL: openwetware.org

• Functional magnetic resonance imaging
• Science
• Neuroscience
• Clinical research
• Medicine
• Neuroimaging
• Magnetic resonance imaging