Dorset / Broma / Houston / Chichester / Cheshire / Iowa City / Tokyo / Bilthoven / Samara / Irvine / Birmingham / New York / Sydney / GRONTHOS ET / Mannheim / Sunnyvale / Melbourne / Adelaide / San Diego / Berkshire / /
Company
Sigma Aldrich Pty. Ltd. / Blackwell Science Inc. / AGGGCTCCAACGAGATCGAGATCCG LP / 2nd Ed. Cold Spring Harbor Laboratory Press / Southern Biotechnology Associates / Fedack SA / TAAB Laboratories / Freedman LP / TTGACCTCAACTACATGG LP / BDH Chemicals Ltd. / GTGGACGAGGCAAGAGTTTCA LP / Mann KG / TCAGCATTTTGGGAATGGCC LP / Weiner LP / ATGAGGGCCTGGATCTTCTT LP / ATGAGAGCCCTCACACTCCTC LP / Simmons / Pharmacia / TTGCTTTTGCCTCCTAGGCA LP / PerkinElmer / Tracor Europa B.V. / Matthew Roberts Laboratory / IgG / Flow Laboratories / LG / David Bull Laboratories / Biotecx Laboratories Inc. / Boehringer Mannheim GMBH / Raven Press / Developmental Studies Hybridoma Bank / Worthington Biochemical Co. / Becton Dickinson / Shimizu / AGGAACAGATCTTCCTGCTGCA LP / John Wiley & Sons / analyzed using a Tracor-Northern Series / /
Country
Netherlands / Japan / Australia / United Kingdom / Scotland / Germany / Sweden / United States / /
Currency
pence / /
Facility
Rundle Mall / University of Adelaide / Iowa University / Cold Spring Harbor / Royal Adelaide Hospital / /
IndustryTerm
ethanol solutions / energy / culture systems / bone chips / gene product / mineral oil / biosynthetic product / /
MedicalCondition
JE / dentinogenesis imperfecta type II / Cancer / Favus MJ / Paget’s disease / Osteoporosis / Disorders / Cancer Research I.M / human lung cancers / bone diseases / /
Organization
University of Adelaide / Iowa University / Human Ethics Committee / S. Gronthos Matthew Roberts Laboratory Leukaemia Research Unit Hanson Centre / American Society for Bone / Leukemia Research Unit / Center for Cancer Research / Anti-Cancer Foundation of the Universities / American Society for Bone and Mineral Research Differential Cell Surface Expression of the STRO-1 / Royal Adelaide Hospital / National Health and Medical Research Council of Australia / Department of Orthopaedics and Trauma / Department of Orthopaedic Surgery and Trauma / Federal Government / Genomic / /
Person
Elmer Cetus / S. Schultz / D.W. Howie / Lincoln Park / Prince / R. Mason / K. Smith / STAN GRONTHOS / Van Vlasselaer / /
Position
thermal cycler / Bone Miner / RT / Bronson RT / using Fisher / representative / model of human bone cell development / marker representative / MP / Singer FR / Prince / model of bone cell development / Fisher / Mark MP / Butler / /
Product
DV / dexamethasone sodium phosphate / Single-cell suspensions / sterile water / balanced salt / /
ProgrammingLanguage
ML / /
ProvinceOrState
Alabama / New York / South Australia / New South Wales / /