R-factor - PDFSEARCH.IO - Document Search Engine

R-factor
Results: 684

#	Item
331	1010data Test Monitor ™ Test the Success of Your New Innovations[removed]D ATA’ S C O N T R O L L E D S T O R E T E S T I N G A P P L I C AT I O N Add to Reading List Source URL: www.1010data.com Language: English - Date: 2014-01-11 23:34:33 Tests Psychometrics Sports science G factor Statistical power Pre- and post-test probability Statistics Educational psychology Education
332	Downloaded from genesdev.cshlp.org on August 4, [removed]Published by Cold Spring Harbor Laboratory Press Differential display of DNA-binding proteins reveals heat-shock factor 1 as a circadian transcription factor Hans R Add to Reading List Source URL: www.molbio.unige.ch Language: English - Date: 2011-06-08 05:03:14 BMAL CLOCK Suprachiasmatic nucleus Period Circadian oscillator Circadian rhythm PER2 DNA-binding protein ARNTL Biology Transcription factors HSF1
333	REPORTS 5. S. A. Thomas, A. M. Matsumoto, R. D. Palmiter, Nature 374, [removed]T. M. Tzschentke, Prog. Neurobiol. 56, [removed]J. R. Schank et al., Neuropsychopharmacology, published online 14 December 2005 ( Add to Reading List Source URL: www.psych.uni-goettingen.de Language: English - Date: 2012-02-19 14:06:46 Philosophy of science Statistical models Causality Graphical models Conditionals Psychology Bayesian network G factor Causal sets Science Physics Statistics
334 $Powder diffraction / Crystallography / Atomic form factor / Scattering / Electron / Neutron / Neutron diffraction / Helium atom scattering / Physics / Diffraction / Atomic physics$	Fundamentals of diffraction * We will remove this simplification later. /\|R-r1\|2 Add to Reading List Source URL: www.psi.ch Language: English - Date: 2015-01-08 06:22:31 Powder diffraction Crystallography Atomic form factor Scattering Electron Neutron Neutron diffraction Helium atom scattering Physics Diffraction Atomic physics
335	Table 1s. Primer sequences used for RT-PCR analyses. Gene Size Primer Sequence (5’ to 3’) ABCG2 684 bp hABCG2-F gtttatccgtggtgtgtctgg hABCG2-R ctgagctatagaggcctggg Add to Reading List Source URL: www.grc.nia.nih.gov Language: English - Date: 2007-10-11 22:01:00 RE1-silencing transcription factor Zinc finger Biology Transcription factors Gene expression
336	Dev Genes Evol[removed]:179–183 DOI[removed]s004270000132 S H O R T C O M M U N I C AT I O N Catherine M. Nolan · J. Keith Killian Add to Reading List Source URL: www.geneimprint.com Language: English - Date: 2012-06-22 09:55:51 Insulin-like growth factor 2 Genomic imprinting Mannose 6-phosphate H19 Insulin-like growth factor Parthenogenesis Imprinting Biology Growth factors Peptide hormones
337	RESEARCH REPORTS Biological Y.A. Bobetsis1, S.P. Barros1, D.M. Lin1, J.R. Weidman2, D.C. Dolinoy2, R.L. Jirtle2, K.A. Boggess3, J.D. Beck4, Add to Reading List Source URL: www.geneimprint.com Language: English - Date: 2012-06-22 09:56:05 DNA Molecular genetics Molecular biology Genomics Genomic imprinting Bisulfite sequencing DNA methylation Insulin-like growth factor 2 H19 Genetics Biology Epigenetics
338	#805 Supplementation based on protein or energy ingredients to beef cattle consuming low-quality cool-season forages: II. Performance, reproductive, and metabolic responses of replacement heifers1 B. I. Cappellozza,* R. Add to Reading List Source URL: oregonstate.edu Language: English - Date: 2014-06-09 18:06:47 Cattle Biochemistry Endocrine system Dairy farming Eli Lilly and Company Calf Insulin-like growth factor 1 Insulin-like growth factor Leptin Peptide hormones Biology Growth factors
339	Sixth Edition, last update July 25, 2007 2 Lessons In Electric Circuits, Volume II – AC By Tony R. Kuphaldt Add to Reading List Source URL: allrepairmanuals.com Language: English - Date: 2011-04-26 12:39:26 Electric power Physical quantities Energy storage Electrical impedance Capacitor Power factor Alternating current Electrical reactance Inductor Electromagnetism Electrical engineering Analog circuits
340	This PDF is a selection from an out-of-print volume from the National Bureau of Economic Research Volume Title: Productivity Growth in Japan and the United States Volume Author/Editor: Charles R. Hulten, editor Volume Pu Add to Reading List Source URL: www.nber.org Language: English - Date: 2008-09-26 12:14:13 Economic growth Costs Manufacturing Macroeconomics Productivity Capacity utilization Total factor productivity Cost curve Production function Economics Business Microeconomics

UPDATE