View Document Preview and Link Open Document File Size: 3,07 MB Share Result on Facebook
City AATCACCAGGCAGCAACAG / Hilden / TGAGTGGAAGGAGAGTGAGGA / CTTGGCTGAAGGTGAACAGA / Ottawa / TGGACAGGTTATTCCTCATCG / Munich / CCCCTCTGGTCTATGGCTAC / CAGGAATACACCAGCTTTGCT / Foster City / TCTTGAGGGCATTGTATTTGG / TGGCCCAAACACAAACATAC / / Company DHT / Real-Time PCR Systems / CTL / Affymetrix / Thermo Fisher Scientific Inc / Qiagen / Beckman Coulter / Agilent Technologies Inc / Creative Commons / Bio-Rad / / Country Germany / United States / Canada / / Currency pence / / / Facility Ottawa Hospital Research Institute / University of Ottawa / Fluidics Station / LIMMA pipeline / The Ottawa Hospital / General Campus / / IndustryTerm bioinformatic tools / text mining approach / literature mining / biological and molecular networks / bank acc / bioinfomatic tool / gene networks / software environment http / MedicalCondition menstrual dysfunction / ovarian dysfunction / obesity / heterogeneous disorders / Polycystic ovarian syndrome / thyroid adenoma / follicle cysts / dissociation / anovulation / insulin resistance / common hormonal and metabolic disorders / Ovarian polycystic syndrome / chronic androgen treatment / diabetes / hyperandrogenism / female infertility / metabolic disorder / complex syndrome / ovarian syndrome / / OperatingSystem GCOS / / Organization MADD / Division of Reproductive Medicine / University of Ottawa / Reproductive Biology Unit / Department of Obstetrics & Gynecology / Ottawa Hospital / Interdisciplinary School of Health Sciences / Ottawa Hospital Research Institute / / Position General / author / specific forward / / Product pseudo / GeneChip @rat Genome / estradiol / BMP-2 / Glycine / / ProgrammingLanguage R / / ProvinceOrState California / / Technology Alpha / hybridization / Operating System / laser / single nucleotide polymorphism / DNA Chip / gene expression / http / 230 2.0 Array chip / / URL http / SocialTag 
Polycystic ovarian syndrome is accompanied by repression of gene signatures associated with biosynthesis and metabolism of steroids, cholesterol and lipids