![Sigma factor / RNA polymerase / Promoter / Transcription / TATA box / Regulation of gene expression / Operon / Non-coding RNA / Sigma 38 / Biology / Gene expression / Biochemistry Sigma factor / RNA polymerase / Promoter / Transcription / TATA box / Regulation of gene expression / Operon / Non-coding RNA / Sigma 38 / Biology / Gene expression / Biochemistry](https://www.pdfsearch.io/img/cd4d6f0092a8bd98130140123cf3cea9.jpg)
| Open Document File Size: 3,75 MBShare Result on Facebook
City La Jolla / Valencia / / Company Qiagen / E. / Phusion HF / IgG / Creative Commons / BioMed Central Ltd. / Bio-Rad / Amersham Biosciences / Novo Nordisk / / Country United States / / / Event FDA Phase / Reorganization / / Facility E complex / RNAP complex / Technical University of Denmark / To shed / University of California / / IndustryTerm σ-factor network / peak-finding algorithm / glucose minimal media / transcriptional regulatory networks / data processing / experimental transcription start site / minimal media / regulatory network / σ-network / described protocol / visualization software / transcription start site / complicated σ-factor network / sigma factor network / reconstructed σ-factor network / / Organization Technical University of Denmark / Department of Bioengineering / University of California / San Diego / / Person Phosphate Dependent Exonuclease (Epicentre) / AATGATACGGCGACCACCGACA GGTTCAGAGTTCTACAGTCCGA / Reverse Transcriptase (Invitrogen) / / Position author / GUUCAGAGUUCUACAGUCCGA CGAUC Small RT / RT / Major / CAAGCAGAAGACGGCA TACGANNNNNNNNN Amplification primers Forward / RT / reverse transcription / modified small RNA RT / small RNA RT / / Product M-9 / A280 / ammonium chloride / sodium acetate / K-12 / / ProvinceOrState California / / Technology electrophoresis / DNA Chip / antibodies / Hybridization / gene expression / σ-factor ChIP-chip / recombination system / peak-finding algorithm / σ38 ChIP-chip / previously described protocol / / URL http /
SocialTag |