concurrent helminth infection / T. muris infection / mycobacterial infections / M. bovis BCG infection / interstitial pneumonitis / human M. tb infection / TB / M. tb infection / prior M. bovis BCG infection / parasitic helminth infections / strain / pulmonary pathology / TB disease / RESEARCH ARTICLE Open Access Mycobacterium bovis BCG infection / infection groups / pulmonary histopathology / Pulmonary / BCG infection / TH2-inducing T. muris infection / single pathogen infection / malnutrition / pre-existing infection / helminth infection / disease / Appropriate single infections / Co-infection protocol Two infection / Mycobacterium tuberculosis / chronic / helminth infections / active TB / tumor necrosis / pulmonary inflammatory scores / concurrent infection / BCG murine infection / mycobacterial infection / either infections / either infection / prior mycobacterial infection / infection / inflammation / both infection / subsequent uncontrolled infection / inflammatory / /
MedicalTreatment
adoptive transfer / vaccination / /
Organization
Faculty of Medicine / University of Cape Town / University of Queensland Diamantina Institute / Brisbane / SU Animal Ethics Board / Medicine and Health Sciences Animal Unit / NRF/DST Centre of Excellence / University of Manchester / Division of Molecular Biology and Human Genetics / MRC Centre for Molecular and Cellular Biology / Stellenbosch University / /
Person
HPRT GACTGTAGATTTTATCAGACT / Frank Brombacher / Robin Warren / Allison Bancroft / /
Position
author / Representative / Forward / /
Product
IL-4KO / dextrose / IL-4 / TH2 / CD4 / /
PublishedMedium
Molecular and Cellular Biology / Molecular Biology / /
Technology
alpha / second protocol / antibodies / Co-infection protocol Two infection protocols / gene expression / infection protocols / /