Back to Results
First PageMeta Content
Apoptosis / Immune system / Proteins / Signal transduction / Tumor necrosis factor-alpha / Fas receptor / Apoptosome / Insulin / Caspase 3 / Biology / Cell biology / Programmed cell death


An upper limit for macromolecular crowding effects
Add to Reading List

Open Document

File Size: 448,10 KB

Share Result on Facebook

City

Shanghai / Changsha / SFA / Shenzhen / Beijing / Darville / UFA / /

Company

Rin / R. China 2 State Key Laboratory / Susin SA / 2State Key Laboratory / GenBank / TaKaRa / GE / Google / Beckman Coulter / Extraction Co. Ltd. / Hunan Provincial Key Laboratory / Supercritical Extraction Co. / Creative Commons / BioMed Central Ltd. / BIO-RAD / Allen-Jennings AE / Allen AE / /

Country

Japan / United States / China / /

/

Facility

National Center of Bio / State Key Laboratory of Subhealth Intervention Technology / Key Laboratory of Subhealth Intervention Technology / Hunan Provincial Key Laboratory of Crop Germplasm Innovation / Agricultural University / Hunan Agricultural University / Beijing Genome Institute / /

IndustryTerm

carrier gas / mL sodium hydroxide-carbinol solution / cancer therapy / cell death machinery / solution software / technology development / tumor cells bank / oil / In thorn grape seed oil / model / grape seed oil / thorn grape seeds oil / Diabetes Care / online submission / gene networks / /

MedicalCondition

both human disease / JE / liver dysfunction / dysfunction / absolute insulin deficiency / Chronic exposure / Inflammatory mediators / American Diabetes A / chemically induced diabetes / MS / IDDM / tumor / mitochondrial dysfunction / Insulin deficiency / insulin resistance / chemically induced diabetes mellitus / cancer / hyperglycemia / diabetes / diabetes mellitus / beta-cell dysfunction / Insulin release Background Diabetes / β-cell dysfunction / /

MedicalTreatment

Traditional Chinese medicine / alternative medicine / cancer therapy / /

Organization

Cultivar Variety Examination and Approving Committee of Hunan Province / ATF / National Center / IDF / Beijing Genome Institute / SFA / Hunan Agricultural University / Changsha / United Nations / 3Hunan Agricultural University / Changsha / Ministry of Science and Technology / Chinese Academy of Medical Sciences / /

Person

Gene Expr / Ande SR / Krishna Mohan / /

Position

Forward TCTAGCCGCTCTCTGGACC Reverse TCCTCAAACACCAGTGACCC JNK Forward TCCAGTTCTCGTACCCGCTA Reverse AGCATGGCGTGACACAGTAA p38 Forward / PrimeScriptTM RT / Forward TGGGATGCCTTTGTGGAACT Reverse CAGGTATGCACCCAGAGTGATG Bax Forward / Forward TTCTCCCTGGACGCCACTT Reverse CCTACCCCACTCCCAGTCATT iNOS Forward / μL Forward / qRT-PCR Target genes GAPDH Forward / beta-cell Fas messenger / author / C1000TM Thermal Cycler / Forward / /

ProvinceOrState

Hunan Province / Mayang / Hunan / /

RadioStation

Verhagen AM / /

TVShow

ER / /

Technology

electrophoresis / Biotechnology / Bio technology / apoptosis / Subhealth Intervention Technology / gene expression / treating cancer / Gas Chromatography / /

URL

www.biomedcentral.com/submit / http /

SocialTag