Cincinnati / Campochiaro / Strasbourg / Volketswil / CTCCATGCTGGCAGCGTACA TGCTCATCGGCTTGCAGACC / Melsungen / Buchs / Khan / More / Sion / La Jolla / Berlin / Heidelberg / Lausanne / London / Midland / Mountain View / Basel / Braunschweig / /
Company
Adobe / Dow Corning / GenBank / Adobe Systems / Olympus / GraphPad Software / Honda / Molecular Research Center Inc. / Linked Intellectual Disability Protein PHF6 Associates / /
Country
Germany / Switzerland / France / United Kingdom / China / /
Currency
pence / / /
Facility
PAF1 Complex / Escher1 / 2 Institute / Sun Yat-sen University / terminus of Stra6 / Emory University / Scale bar / Royal College / University of Lausanne / /
Association for Research / IRO-Institut de Recherche / Royal College / Veterinary Service of the State of Valais / Oohira A. Genomic / Emory University / Ecole Polytechnique / Escher1 / 2 Institute for Research / University of Lausanne / Lausanne / Zhongshan Ophthalmic Center / /