Luminex / PCR / Elsevier Inc. / MJ Research Inc. / Affymetrix / Qiagen / CVs / HP / MFI / /
Country
Germany / United States / Greece / / /
Event
FDA Phase / /
Facility
Laboratory of Analytical / University of Athens / General Hospital / / /
IndustryTerm
non-specific products / therapy for HER2-negative metastatic breast cancer / liquid bead microarray technology / liquid bead array technology / distal splice site / hybridization protocol / treatment of non-small cell lung cancer / distal site / treatment of cancer / stock amplicon solutions / reporter solution / /
MedicalCondition
lung carcinoma / colorectal cancer / metastasis / rheumatoid arthritis / adjacent tumor / J Cancer / factor-A isoform-producing tumors / rheumatoid and other disease / NSCLC tumor / metastatic breast cancer / HER2-negative metastatic breast cancer / non-small-cell lung cancer / renal cancer / ovarian tumors / non-small cell lung cancer / breast carcinomas / squamous cell carcinomas / renal cell carcinoma / breast cancer / diabetic retinopathy surgery / breast carcinoma / lung cancers / cancers / tumor / diabetic retinopathy / adenocarcinomas / cancer / tumors / disease / NSCLC / diabetes / malignant melanoma / breast and ovarian cancer / non small cell lung cancer / lung cancer / nonsmall cell lung cancer / Folkman J. Tumor / coronary artery disease / /
MedicalTreatment
surgery / molecular therapies / adjuvant therapy / /
Organization
Food and Drug Administration / General Hospital for Chest Diseases / Canadian Society of Clinical Chemists / Department of Chemistry / Onassis Center for Cardiovascular Diseases / FDA / Laboratory of Analytical / University of Athens / /
Person
Clin Sci / E.S. Lianidou / L. Kaklamanis / A. Tsaroucha / /
Position
thermal cycler / Bone Miner / common forward / author for internal non-commercial research / Harper / Corresponding author / Author / AAAGAAAGAAAGAAAGAAAGTGTA Author / PBGD specific forward / forward / reporter / http /
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and shar