2MT

Results: 6



#Item
1PRESS RELEASE  Writtle Calling / 2EmmaToc 87.7 F M (local area only) Online (writtlecalling.co.uk)

PRESS RELEASE Writtle Calling / 2EmmaToc 87.7 F M (local area only) Online (writtlecalling.co.uk)

Add to Reading List

Source URL: www.writtlecalling.co.uk

Language: English - Date: 2012-08-05 13:37:10
2Writtle Calling / 2EmmaToc Programme Tuesday 11 September 6 – 7.30pm All Saints Bellringers Six Bells The bells of All Saints Church Writtle, including

Writtle Calling / 2EmmaToc Programme Tuesday 11 September 6 – 7.30pm All Saints Bellringers Six Bells The bells of All Saints Church Writtle, including

Add to Reading List

Source URL: www.writtlecalling.co.uk

Language: English - Date: 2012-09-13 10:13:37
3Off-Space Travels Oliver Basciano No 7: Writtle Calling: 2emmatoc An ongoing series of journeys along art roads less travelled – this month a temporary radio station

Off-Space Travels Oliver Basciano No 7: Writtle Calling: 2emmatoc An ongoing series of journeys along art roads less travelled – this month a temporary radio station

Add to Reading List

Source URL: www.writtlecalling.co.uk

Language: English - Date: 2012-10-03 06:46:50
4HindIII  2mt signal sequence MSVLTPLLLRGLTGSARRLPVPRAKIHSLGDPMSVLTPLLLRGLTGSARRLPVPRAKIHSLG  AAGCTTATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTGGGGGATCCC

HindIII 2mt signal sequence MSVLTPLLLRGLTGSARRLPVPRAKIHSLGDPMSVLTPLLLRGLTGSARRLPVPRAKIHSLG AAGCTTATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTGGGGGATCCC

Add to Reading List

Source URL: www.tsienlab.ucsd.edu

- Date: 2014-11-06 19:29:43
    5State Tax Form 2MT  The Commonwealth of Massachusetts Assessors’ Use only

    State Tax Form 2MT The Commonwealth of Massachusetts Assessors’ Use only

    Add to Reading List

    Source URL: www.mass.gov

    Language: English - Date: 2014-01-23 13:59:21
    6Writtle Calling / 2EmmaToc Programme Tuesday 11 September 6 – 7.30pm All Saints Bellringers Six Bells The bells of All Saints Church Writtle, including

    Writtle Calling / 2EmmaToc Programme Tuesday 11 September 6 – 7.30pm All Saints Bellringers Six Bells The bells of All Saints Church Writtle, including

    Add to Reading List

    Source URL: www.writtlecalling.co.uk

    Language: English - Date: 2012-09-16 10:24:17