EcoRI - PDFSEARCH.IO - Document Search Engine

EcoRI
Results: 70

#	Item
31	UPDATED “CLONE THAT GENE” ACTIVITY – 2014 \| TEACHER GUIDE © 2014 Amgen Foundation. All rights reserved. SESSION 2 Key ideas: When creating a recombinant plasmid, it is important to examine the sequences of the pla Add to Reading List Source URL: www.amgenbiotechexperience.com Language: English - Date: 2014-04-30 17:04:03 Plasmid Molecular cloning Genetic engineering EcoRI Recombinant DNA DNA HindIII Restriction fragment CDNA library Biology Molecular biology Restriction enzyme
32	How to Make Good Old-fashioned DIRT from Food Scraps Add to Reading List Source URL: www.ecori.org Language: English - Date: 2014-05-28 10:57:33 Sustainability Soil Composting Organic farming Sustainable gardening Compost Mulch Soil conditioner Spent mushroom compost Agriculture Agroecology Organic gardening
33	City Farm and ecoRI News Partner to Save Food Scraps from Landfill From 2009 to 2013, a farmers market Rich Pederfood-scrap collection program, run by the son, head farmer outreach arm of the Providence-based non- at Cit Add to Reading List Source URL: southsideclt.org Language: English - Date: 2013-06-19 10:24:04 Organic gardening Organic farming Soil Compost Waste management EcoRI Manure Urban agriculture Agriculture Environment Biology
34	How to Make Compost Using WORMS It’s not magic. Add to Reading List Source URL: www.ecori.org Language: English - Date: 2014-05-28 10:57:34 Sustainability Composting Vermicompost Soil Organic farming Compost Eisenia fetida Earthworm Worm Organic gardening Agriculture Environment
35	Notes on the AAV2 vectors Add to Reading List Source URL: www.tsienlab.ucsd.edu Language: English - Date: 2014-11-06 19:29:41 Biochemistry BglII EcoRI SV40 HindIII BamHI Citrine Kozak Vector Biology Molecular biology Restriction enzymes
36	The if statement and files The if statement Do a code block only when something is True if test: Add to Reading List Source URL: www.dalkescientific.com Language: English - Date: 2004-04-12 00:34:41 EcoRI Computer programming Computing Python Molecular biology Restriction enzymes Software engineering
37	EcoRI (437bp) EcoRI (396bp) SCre Amp R Add to Reading List Source URL: www.biosupport.kazusa.or.jp - Date: 2011-04-17 21:18:44
38	EcoRI (396bp) SacI (406bp) KpnI (412bp) SloxM1 MluI (482bp) NotI (489bp) Add to Reading List Source URL: www.biosupport.kazusa.or.jp - Date: 2011-04-17 21:18:44
39	EcoRI (396bp) SacI (406bp) KpnI (412bp) VloxP MluI (482bp) NotI (489bp) Add to Reading List Source URL: www.biosupport.kazusa.or.jp - Date: 2011-04-17 21:18:44
40	D1ER in pcDNA3; 5’HindIII, 3’EcoRI aagcttgcggccgccacatgctgctgcccgtccccctgctgctgggcctgctgggcgccgccgccgacgtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaggttcagcgtgtccggcgagggcgagggcgatgccac Add to Reading List Source URL: www.tsienlab.ucsd.edu Language: Somali - Date: 2014-11-06 19:29:42