Nucleoside - PDFSEARCH.IO - Document Search Engine

Nucleoside
Results: 353

#	Item
81	Research Recherche Canadian consensus guidelines for the management of pregnant HIV-positive women and their offspring David R. Burdge, Deborah M. Money, John C. Forbes, Sharon L. Walmsley, Fiona M. Smaill, Add to Reading List Source URL: www.cmaj.ca Language: English - Date: 2003-06-24 15:11:02 Health Cyclopropanes Non-nucleoside reverse transcriptase inhibitors Pandemics Obstetrics Antiretroviral drug Nevirapine HIV AIDS HIV/AIDS Medicine Chemistry
82	MISSISSIPPI DIVISION OF MEDICAID Pharmacy & Therapeutics Committee Meeting Woolfolk Building Conference Center East, Room 145 Jackson, MS[removed] Add to Reading List Source URL: www.medicaid.ms.gov Language: English - Date: 2014-12-16 19:38:40 Non-nucleoside reverse transcriptase inhibitors Euphoriants Morphinans Phenols Bupropion Antidepressant Venlafaxine Tramadol Nevirapine Chemistry Organic chemistry Alcohols
83	FDA Tentative Approval November 8, 2005 Lamivudine Oral Solution (10 mg/mL) Aurobindo Pharma, Ltd. 1 Add to Reading List Source URL: apps.who.int Language: English - Date: 2009-12-08 04:25:30 Organic chemistry Cyclopropanes Antiretroviral drug Reverse-transcriptase inhibitor Fixed dose combination Purines Non-nucleoside reverse transcriptase inhibitors Abacavir Organofluorides Chemistry Lamivudine
84	FDA Tentative Approval[removed]Efavirenz Capsules 50 mg, 100 mg, and 200 mg Aurobindo Pharma, Ltd. 1 Add to Reading List Source URL: apps.who.int Language: English - Date: 2009-11-10 08:30:56 Non-nucleoside reverse transcriptase inhibitors Cyclopropanes Organofluorides Alkynes Efavirenz Antiretroviral drug Reverse-transcriptase inhibitor Simvastatin Atazanavir Chemistry Bristol-Myers Squibb Organic chemistry
85	FDA Tentative Approval[removed]Nevirapine Tablets 200 mg Huahai Pharmaceuticals Co., Ltd. 1 Add to Reading List Source URL: apps.who.int Language: English - Date: 2009-12-08 04:14:12 Non-nucleoside reverse transcriptase inhibitors Cyclopropanes Lactams Nevirapine Eli Lilly and Company Antiretroviral drug Reverse-transcriptase inhibitor Pre-exposure prophylaxis Pioglitazone Chemistry Organic chemistry Pyridines
86	HIV/AIDS Expression of Interest EOI Add to Reading List Source URL: apps.who.int Language: English - Date: 2008-05-28 07:41:36 Organofluorides Bristol-Myers Squibb Non-nucleoside reverse transcriptase inhibitors Purines Fixed-dose combination Antiretroviral drug ATC code J05 Lamivudine Reverse-transcriptase inhibitor Chemistry Organic chemistry Cyclopropanes
87	Additional file 1 Table S1. Bovine oligonucleotide primers used for qPCR Gene Symbol Primers (5’ to 3’) Product[removed]size Efficiency1 Accession Number Nucleoside transporters SLC28A1 F: AGAAGTGAGGAAGGCGTGAA Add to Reading List Source URL: t-stor.teagasc.ie Language: English - Date: 2014-10-22 21:01:38
88	Kansas Ryan White ADAP Formulary HIV Anti‐Retroviral Non‐Nucleoside Reverse Transcriptase Inhibitors (NNRTI) Generic Name Brand Name delavirdine mesylate Add to Reading List Source URL: www.kdheks.gov Language: English - Date: 2014-12-03 10:35:25
89	World Health Organization 2007 All rights reserved. The document may not be reviewed, abstracted, quoted, reproduced, transmitted, distributed, translated or adapted, in part or in whole, in any form or by any means Add to Reading List Source URL: apps.who.int Language: English - Date: 2007-11-29 06:59:40 Health Cyclopropanes Non-nucleoside reverse transcriptase inhibitors Bristol-Myers Squibb HIV/AIDS Antiretroviral drug Nevirapine Essential medicines Fixed-dose combination Pharmacopoeias Pharmacology Chemistry
90	Oklahoma HDAP Formulary effective[removed]FY 2014 Oklahoma HIV Drug Assistance Program Drug Formulary Brand Generic Aptivus Add to Reading List Source URL: www.ok.gov Language: English - Date: 2014-09-15 15:15:59 Organic chemistry Pharmacology Organofluorides Cyclopropanes Non-nucleoside reverse transcriptase inhibitors ATC code J05 Tenofovir Emtricitabine Abacavir Fixed dose combination Gilead Sciences Chemistry