SCOWLP update: 3D classification of protein-protein, -peptide, -saccharide and -nucleic acid interactions, and structure-based binding inferences across folds

First Page		Document Content
Bioinformatics DNA sequencing Genomics Strand Life Sciences Copy-number variation Sequence assembly Full genome sequencing Genome project FASTQ format Biology Genetics Molecular biology		SCOWLP update: 3D classification of protein-protein, -peptide, -saccharide and -nucleic acid interactions, and structure-based binding inferences across folds Add to Reading List Source URL: www.ncbi.nlm.nih.gov Download Document from Source Website File Size: 753,86 KB Share Document on Facebook

	Targeted analysis of nucleotide and copy number variation by exon capture in allotetraploid wheat genome DocID: 1oZwn - View Document
	Open Up More Treatment Possibilities For Your Patients About FoundationOne® FoundationOne is a validated comprehensive Genomic Profile that interrogates the entire coding sequence of 315 cancer-related genes plus selec DocID: 1m3P8 - View Document
	S YSTEMS TOXICOLOGY Developing Mechanistic Understanding of Toxicity Pathways and Establishing Predictive Toxicology for Use in Risk Assessments V-Continent Parkview WuZhou Hotel, Beijing, China DocID: 18ulA - View Document
	Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and DocID: 18mDV - View Document
	RNA-Seq Gene Expression Analysis April 23, 2014 RNA-Seq How-To A Lumenogix White Paper DocID: 15PVg - View Document