Strand Life Sciences - PDFSEARCH.IO - Document Search Engine

Strand Life Sciences
Results: 14

#	Item
1	Targeted analysis of nucleotide and copy number variation by exon capture in allotetraploid wheat genome Add to Reading List Source URL: www.cs.tau.ac.il Language: English - Date: 2015-06-23 04:58:13 Molecular biology Biotechnology DNA sequencing Genomics Bioinformatics Whole genome sequencing Personal genomics Exome sequencing Strand Life Sciences 454 Life Sciences Single-nucleotide polymorphism SAMtools
2	Open Up More Treatment Possibilities For Your Patients About FoundationOne® FoundationOne is a validated comprehensive Genomic Profile that interrogates the entire coding sequence of 315 cancer-related genes plus selec Add to Reading List Source URL: www.foundationmedicine.com Language: English - Date: 2015-07-29 10:38:28 Tyrosine kinase receptors Pfizer Cancer Occupational safety and health Pathology RTT Targeted therapy Anaplastic lymphoma kinase ROS1 Crizotinib Erlotinib Strand Life Sciences
3	S YSTEMS TOXICOLOGY Developing Mechanistic Understanding of Toxicity Pathways and Establishing Predictive Toxicology for Use in Risk Assessments V-Continent Parkview WuZhou Hotel, Beijing, China Add to Reading List Source URL: www.thehamner.org Language: English - Date: 2014-10-23 13:26:22 Toxicology Genomics Agilent Technologies Hewlett-Packard In vitro toxicology Metabolomics Strand Life Sciences Animal testing In vitro Science Biology Scientific method
4	Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and Add to Reading List Source URL: rw.mammoth.psu.edu Language: English - Date: 2008-12-01 13:55:23 Genetics DNA Biotechnology Base pair Nucleic acid sequence Complementarity Pyrosequencing Polymerase chain reaction 454 Life Sciences Biology Molecular biology DNA sequencing
5	RNA-Seq Gene Expression Analysis April 23, 2014 RNA-Seq How-To A Lumenogix White Paper Add to Reading List Source URL: inf.lumenogix.com Language: English - Date: 2014-11-13 03:16:52 Genetics Molecular biology Microarrays RNA RNA-Seq Alternative splicing Strand Life Sciences DNA microarray Biology Gene expression Biochemistry
6	RNA Expression Time Course Analysis April 23, 2014 RNA Time Course Analysis How-To A Lumenogix White Paper Add to Reading List Source URL: inf.lumenogix.com Language: English - Date: 2014-11-13 03:16:52 Gene expression Microarrays DNA sequencing RNA RNA-Seq Alternative splicing Strand Life Sciences DNA microarray Biology Biochemistry Molecular biology
7	Strand 1: Biological Sciences Through the exploration of the life cycles of select flora and fauna, students learn about basic needs for survival. Whilst investigating the innate ability of plants to adapt to their surr Add to Reading List Source URL: actf.com.au Language: English - Date: 2014-09-10 22:08:22 Magnet Mathematics education Stationery Worksheet
8	Agilent Technologies Genomics Seminar at Purdue University Sponsored by: Bioinformatics Core (Cyber Center, Discovery Park) at Purdue University Friday November 16, 2012 Add to Reading List Source URL: www.purdue.edu Language: English RNA Protein methods Gene expression RNA-Seq Agilent Technologies Chip-sequencing Strand Life Sciences Biology Biochemistry Molecular biology
9	Appendix E Massachusetts Curriculum Frameworks Following are some examples of alignment between Planet Health and the Massachusetts Curriculum Add to Reading List Source URL: www.planet-health.org Language: English - Date: 2007-06-22 11:34:40 Health sciences Self-care Knowledge Personal life Human nutrition Strand Nutrition Applied sciences Food science Health
10	Weather Patterns Strand Earth Patterns, Cycles, and Changes Topic Investigating weather patterns Primary SOL K.9 The student will investigate and understand that there are simple repeating patterns in his/her daily life. Add to Reading List Source URL: www.doe.virginia.gov Language: English - Date: 2012-08-24 10:17:45 Precipitation Surface weather observation Weather forecasting Weather Rain Snow Weather lore NOAA Weather Radio Meteorology Atmospheric sciences Weather prediction

UPDATE