R-expression - PDFSEARCH.IO - Document Search Engine

R-expression
Results: 451

#	Item
191	2 C-III/120/R-rev INTER-PARLIAMENTARY UNION Add to Reading List Source URL: www.ipu.org Language: English - Date: 2009-01-12 11:52:38 Human rights Freedom of expression Law Freedom of information Right to Information Act Freedom of Information Act Privacy Freedom of the press Freedom of speech by country Ethics Freedom of information legislation Freedom of speech
192	Comparative promoter region analysis powered by CORG. Christoph Dieterich∗1 , Steffen Grossmann1 , Andrea Tanzer2,3 , Stefan R¨opcke1 , Peter F. Arndt1 , Peter F. Stadler2,3 and Martin Vingron1 1 2 3 Add to Reading List Source URL: lips.informatik.uni-leipzig.de Language: English - Date: 2009-09-10 09:47:25 Bioinformatics DNA RNA Promoter Phylogenetic footprinting Noncoding DNA Gene Conserved sequence Regulatory sequence Biology Genetics Gene expression
193	Supplementary Table 1 Extension of Table 2 with all shifts in cardiac gene expression down to 1.5-fold change for DCMi patient group vs CONT control group, as assessed by Affymetrix microarray analysis of RNA extracted f Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Transcription factors R-SMAD Biology Protein domains Protein structure
194	Table 1s. Primer sequences used for RT-PCR analyses. Gene Size Primer Sequence (5’ to 3’) ABCG2 684 bp hABCG2-F gtttatccgtggtgtgtctgg hABCG2-R ctgagctatagaggcctggg Add to Reading List Source URL: www.grc.nia.nih.gov Language: English - Date: 2007-10-11 22:01:00 RE1-silencing transcription factor Zinc finger Biology Transcription factors Gene expression
195	Syringyl lignin biosynthesis is directly regulated by a secondary cell wall master switch Qiao Zhaoa, Huanzhong Wanga, Yanbin Yinb,c, Ying Xub,c, Fang Chena,c, and Richard A. Dixona,c,1 a Plant Biology Division, Samuel R Add to Reading List Source URL: bioenergycenter.org Language: English - Date: 2010-08-03 12:46:32 Genomics Transcription factors Lignin Papermaking Monolignol Arabidopsis thaliana Ridge Medicago truncatula SND1 Biology Gene expression Model organisms
196	BriefDefinitive Report Expression of Variants of the Major Surface Glycoprotein of Pneumocystis carinii B y C . W i l l i a m Angus,* A l e x Tu,* P e t e r V o g e l , ~ M e i Q i n , * a n d J o s e p h A. Kovacs* Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English HIV/AIDS Pneumocystis pneumonia Pneumonia AIDS Antigenic variation Opportunistic infection Monosodium glutamate HIV Pneumocystis jirovecii Health Medicine Biology
197	Proceedings of the 2007 Conference on New Interfaces for Musical Expression (NIME07), New York, NY, USA Don’t Forget the Laptop: Using Native Input Capabilities for Expressive Musical Control Rebecca Fiebrink, Ge Wang Add to Reading List Source URL: www.nime.org Language: English - Date: 2014-12-19 08:56:05 Audio programming languages Software synthesizers Software Laptop Computer hardware Touchpad ChucK Pointing device Perry R. Cook Computing PLOrk Electronic music
198	Expression of Resistance to Xanthomonas campestris pv. phaseoli in Phaseolus vulgaris Under Tropical Conditions D. M. WEBSTER, Twin Falls, ID 83316, and S. R. TEMPLE and G. GALVEZ, CIAT, Cali, Colombia acutifolius Grey l Add to Reading List Source URL: www.apsnet.org Language: English - Date: 2010-05-19 19:38:41 Mycology Alternaria Bacterial blight Fungicide Blight Rust Maize Biology Microbiology Food and drink
199	Comparative Phylogenetic Analysis of Blcap/Nnat Reveals Eutherian-Specific Imprinted Gene Heather K. Evans,* Jennifer R. Weidman,* Dale O. Cowley,à and Randy L. Jirtle* Department of Radiation Oncology, Duke Univ Add to Reading List Source URL: www.geneimprint.com Language: English* - Date: 2012-06-22 09:56:00 Epigenetics DNA Genetic mapping Genomic imprinting Insulin-like growth factor 2 H19 NNAT CTCF Intron Biology Genetics Gene expression
200	Comparative phylogenetic analysis reveals multiple non-imprinted isoforms of opossum Dlk1 Jennifer R. Weidman,1,2 Kristin A. Maloney,1 3 Add to Reading List Source URL: www.geneimprint.com Language: English - Date: 2012-06-22 09:56:02 Non-coding RNA MEG3 Genomic imprinting DLK1 Pseudogene Imprinting Ridge EGF-like domain Insulin-like growth factor 2 Biology Genetics Gene expression

UPDATE