1![Genome Informatics 13: 297–Prediction of Co-Regulated Genes in Eubacterial Genomes by Phylogenetic Footprinting Genome Informatics 13: 297–Prediction of Co-Regulated Genes in Eubacterial Genomes by Phylogenetic Footprinting](https://www.pdfsearch.io/img/a753ebcbe01da0d2de3f5840d67c98e6.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2002-12-19 23:03:40
|
---|
2![EUPROFILE Genome ‘dark matter’ Computing the missing components in inflammatory EUPROFILE Genome ‘dark matter’ Computing the missing components in inflammatory](https://www.pdfsearch.io/img/197091f2f632a8c816ad787447937c0c.jpg) | Add to Reading ListSource URL: rth.dkLanguage: English - Date: 2012-03-31 10:28:12
|
---|
3![Genome Informatics 13: 299–Development of an Efficient Method to Search Conserved Noncoding Sequences Genome Informatics 13: 299–Development of an Efficient Method to Search Conserved Noncoding Sequences](https://www.pdfsearch.io/img/f92d4d1506dedb3ac080fc3436c7000a.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2002-12-19 23:03:34
|
---|
4![1 Biol. Rev), 80, pp. 1–24. f Cambridge Philosophical Society DOI : S1464793104006657 Printed in the United Kingdom Why repetitive DNA is essential to 1 Biol. Rev), 80, pp. 1–24. f Cambridge Philosophical Society DOI : S1464793104006657 Printed in the United Kingdom Why repetitive DNA is essential to](https://www.pdfsearch.io/img/23527b6248408e0b4d7e7761c2cb198c.jpg) | Add to Reading ListSource URL: shapiro.bsd.uchicago.eduLanguage: English - Date: 2005-02-08 16:23:10
|
---|
5![NEWS & VIEWS G E NOM ICS Mice in the ENCODE spotlight Following on from affiliated projects in humans and model invertebrates, the Mouse ENCODE Project presents comprehensive data sets on genome regulation in this key ma NEWS & VIEWS G E NOM ICS Mice in the ENCODE spotlight Following on from affiliated projects in humans and model invertebrates, the Mouse ENCODE Project presents comprehensive data sets on genome regulation in this key ma](https://www.pdfsearch.io/img/9cbc61e8c8c0cf72812ab2374fc7b2a2.jpg) | Add to Reading ListSource URL: elbo.gs.washington.eduLanguage: English - Date: 2014-11-19 18:48:59
|
---|
6![Who believes in whole-genome scans for selection? Who believes in whole-genome scans for selection?](https://www.pdfsearch.io/img/03ddac53f9c71ee02043934ed087aedc.jpg) | Add to Reading ListSource URL: www.mabs.atLanguage: English - Date: 2009-09-24 17:33:44
|
---|
7![Use of the Gene Trap Resource for Cancer-related lncRNAs to Study the Role of Malat1 in Pancreatic Cancer. Andrei Golovko1, Huiping Guo1, Amy Gonzales1, Stephen H. Safe2, Indira Jutooru2, Parisa Imanirad2, and Benjamin M Use of the Gene Trap Resource for Cancer-related lncRNAs to Study the Role of Malat1 in Pancreatic Cancer. Andrei Golovko1, Huiping Guo1, Amy Gonzales1, Stephen H. Safe2, Indira Jutooru2, Parisa Imanirad2, and Benjamin M](https://www.pdfsearch.io/img/dabbf05bd897d6cb593eca551ad973ac.jpg) | Add to Reading ListSource URL: www.tigm.orgLanguage: English - Date: 2015-06-17 13:36:12
|
---|
8![Press Release September 1st, 2005 (Eastern Time, USA) The FANTOM Consortium for Genome Exploration Research Group, RIKEN Genomic Sciences Center (GSC), RIKEN Yokohama Institute and Genome Science Laboratory, Discovery an Press Release September 1st, 2005 (Eastern Time, USA) The FANTOM Consortium for Genome Exploration Research Group, RIKEN Genomic Sciences Center (GSC), RIKEN Yokohama Institute and Genome Science Laboratory, Discovery an](https://www.pdfsearch.io/img/ba85d05b6a2a671728623a878b9555a6.jpg) | Add to Reading ListSource URL: fantom.gsc.riken.jpLanguage: English - Date: 2005-09-01 03:51:08
|
---|
9![GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA](https://www.pdfsearch.io/img/4d7f36685ef93ca9ba8d30394145153d.jpg) | Add to Reading ListSource URL: bejerano.stanford.eduLanguage: English - Date: 2009-04-17 16:28:41
|
---|
10![22 A STRUCTURAL GENOMICS APPROACH TO THE REGULATION OF APOPTOSIS: CHIMP VS. HUMAN JESSICA AHMED 22 A STRUCTURAL GENOMICS APPROACH TO THE REGULATION OF APOPTOSIS: CHIMP VS. HUMAN JESSICA AHMED](https://www.pdfsearch.io/img/b4d251f78e0e0b8a906839bad508407b.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2007-09-27 22:52:24
|
---|