CD36 - PDFSEARCH.IO - Document Search Engine

CD36
Results: 38

#	Item
1	Vol 450 \| 8 November 2007 \| doi:nature06328 LETTERS An essential role for a CD36-related receptor in pheromone detection in Drosophila Richard Benton1{, Kirsten S. Vannice1{ & Leslie B. Vosshall1 Add to Reading List Source URL: vosshall.rockefeller.edu Language: English - Date: 2013-05-01 11:28:42
2	Loss of SR-A and CD36 Activity Reduces Atherosclerotic Lesion Complexity Without Abrogating Foam Cell Formation in Hyperlipidemic Mice Jennifer J. Manning-Tobin, Kathryn J. Moore, Tracie A. Seimon, Susan A. Bell, Maia Sh Add to Reading List Source URL: www.tabaslab.com Language: English - Date: 2012-04-03 00:06:10
3	Cell Metabolism Article Atherogenic Lipids and Lipoproteins Trigger CD36-TLR2-Dependent Apoptosis in Macrophages Undergoing Endoplasmic Reticulum Stress Add to Reading List Source URL: www.tabaslab.com Language: English - Date: 2012-04-03 00:08:13
4	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
5	This is an excerpt from Parasitic Diseases 5th Edition Visit www.parasiticdiseases.org for order information Fifth Edition Parasitic Add to Reading List Source URL: www.medicalecology.org Language: English - Date: 2014-06-11 11:28:38 Biology Plasmodium malariae Malaria Antimalarial medication Blood film Chloroquine Hemozoin CD36 Pamaquine Plasmodium Medicine Microbiology
6	CALIFORNIA STATE SCIENCE FAIR 2015 PROJECT SUMMARY Name(s) Project Number Add to Reading List Source URL: www.usc.edu Language: English - Date: 2015-04-06 12:54:52 Obesity Nutrition Body shape Bariatrics Single-nucleotide polymorphism FTO gene TAS2R38 Childhood obesity CD36 Biology Genetics Medicine
7	CCAR Investigators Present Findings at the 2014 Annual Society of Toxicology (SOT) Meeting Matthew Campen of the University of New Mexico co-chaired a SOT Symposium entitled: Role of Circulating Factors in Mediating Syst Add to Reading List Source URL: depts.washington.edu Language: English - Date: 2015-02-09 13:57:05 Receptors CD36
8	Vasina_et_al_2011_Figure 1 Add to Reading List Source URL: www.nature.com Language: English - Date: 2011-11-25 08:50:48 Immune system Coagulation system Immunology CCL2 Macrophage Monocyte Platelet Microparticles CD36 Biology Cell biology Cytokines
9	OPEN Citation: Cell Death and Disease[removed], e971; doi:[removed]cddis[removed] & 2013 Macmillan Publishers Limited All rights reserved[removed]www.nature.com/cddis Add to Reading List Source URL: www.nature.com Language: English Programmed cell death Parasites Antimalarial medication Parasitism CD36 Apicoplast Apoptosis Pyknosis Plasmodium falciparum biology Biology Plasmodium Malaria
10	Single-molecule imaging reveals how cells prepare to interact with the world Add to Reading List Source URL: phys.org Language: English - Date: 2015-03-04 04:34:08 Membrane biology Cytoskeleton Cell signaling Actin CD36 Immune system Cell Outline of cell biology T cell Biology Cell biology Receptors

UPDATE