Dehydrogenase - PDFSEARCH.IO - Document Search Engine

Dehydrogenase
Results: 908

#	Item
51	Medication-induced mitochondrial damage and disease Add to Reading List Source URL: psychrights.org Language: English - Date: 2008-10-13 17:07:40 Biochemistry Mitochondrion Mitochondrial DNA Reactive oxygen species Mitochondrial disease NADH dehydrogenase Electron transport chain Oxidative phosphorylation MELAS syndrome Biology Cellular respiration Chemistry
52	Identification and quantitation of cysteine sulfoxidation sites Chia-Fang Lee1, Tanya T. Paull2, and Maria D. Person1 1Protein and Metabolite Analysis Facility, College of Pharmacy, 1,2Institute for Cellular and Molecula Add to Reading List Source URL: www.utexas.edu Language: English - Date: 2013-03-18 11:08:33 Protein structure Cysteine Thiols Sulfonic acid Glyceraldehyde 3-phosphate dehydrogenase Sulfinic acid Posttranslational modification Prolyl isomerase Chemistry Biology Organic chemistry
53	Simulation of human erythrocyte using E-CELL System Add to Reading List Source URL: icsb-2001.org Language: English - Date: 2001-12-04 14:14:36 Metabolic pathways EC 1.1.1 Glucose-6-phosphate dehydrogenase Antioxidants Cellular respiration Hematology Pentose phosphate pathway Glycolysis Glutathione Chemistry Biology Biochemistry
54	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
55	Building a Computer Simulation of Threonine Synthesis in Escherichia coli David A. Fell ∗ Add to Reading List Source URL: icsb-2001.org Language: English - Date: 2001-12-04 14:14:35 Homoserine dehydrogenase Aspartokinase UDP-glucose 4-epimerase Homoserine Metabolism Amino acid kinase Chemistry EC 1.1.1 Threonine
56	Why does natural selection maintain high G6PD activities? Armindo Salvador Michael A. Savageau Dept. of Microbiology & Immunology Add to Reading List Source URL: icsb-2001.org Language: English - Date: 2001-12-04 14:14:36 Biochemistry EC 1.1.1 Glucose-6-phosphate dehydrogenase Coenzymes Glutathione reductase Red blood cell Glutathione Vitamin C Metabolism Chemistry Biology Antioxidants
57	PDF Document Add to Reading List Source URL: www.nasonline.org Language: English - Date: 2014-03-14 12:31:36 Transition metals Bert L. Vallee Zinc Alcohol dehydrogenase Cadmium Metallothionein Enzyme Chemistry Chemical elements Post-transition metals
58	PDF Document Add to Reading List Source URL: www.parazitologie.cz Language: English - Date: 2015-03-27 15:55:43 Euglenozoa Biochemistry Bodo saltans Crithidia fasciculata Leishmania Oxidative phosphorylation NADH dehydrogenase Electron transport chain Alternative oxidase Biology Cellular respiration Integral membrane proteins
59	TSA_EST data Entry COMMON Feature DATE Add to Reading List Source URL: www.ddbj.nig.ac.jp Language: English - Date: 2015-02-12 00:59:15 Glyceraldehyde-3-phosphate dehydrogenase (NADP+) Glyceraldehyde-3-phosphate dehydrogenase Dehydrogenase Glyceraldehyde 3-phosphate Mishima Shizuoka Chemistry Chemical kinetics Physical chemistry
60	Sample Annotation File: TSA (Transcriptome Shotgun Assembly) primary entries are from EST This line is not required for annotation file. Entry Feature COMMON DIVISION Add to Reading List Source URL: www.ddbj.nig.ac.jp Language: English - Date: 2015-02-12 00:43:27 Glyceraldehyde-3-phosphate dehydrogenase Transcriptome Biology Chemistry Physical chemistry

UPDATE