Glutamate - PDFSEARCH.IO - Document Search Engine

Glutamate
Results: 474

#	Item
61	Glutamate is an inhibitory neurotransmitter in the Drosophila olfactory system Wendy W. Liu and Rachel I. Wilson1 Department of Neurobiology, Harvard Medical School, Boston, MAEdited by Liqun Luo, Stanford Univers Add to Reading List Source URL: wilson.med.harvard.edu Language: English - Date: 2013-06-16 11:20:04 Neurotransmitters Transmembrane receptors G protein coupled receptors Amino acids Limbic system Antennal lobe Olfactory bulb Gamma-Aminobutyric acid Neuron Biology Chemistry Anatomy
62	TIG100 Smarter sorting of lumber Know green board density and stiffness for more effective MSR/MSG processing Add to Reading List Source URL: www.gns.cri.nz Language: English - Date: 2010-08-26 01:19:29 Lumber Timber industry Matter Building materials GNS Science Monosodium glutamate Lower Hutt Visual arts Forestry Food and drink Wood
63	Perfumer & Flavorist - January 2014 Add to Reading List Source URL: www.leffingwell.com Language: English - Date: 2013-12-20 09:30:05 Flavors Glutamates Food science Food additives Sodium compounds Senomyx Ethyl butyrate Monosodium glutamate Umami Chemistry Food and drink Food industry
64	Mushrooms: The Superfood for Coeliacs and the Gluten Intolerant. powerofmushrooms.com.au Add to Reading List Source URL: www.powerofmushrooms.com.au Language: English - Date: 2014-08-06 04:19:33 Food additives Sodium compounds Gluten-free diet Gluten Coeliac disease Glutamic acid Monosodium glutamate Agaricus bisporus Soy sauce Food and drink Glutamates Diets
65	Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Language: English Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry
66	KFC13129-02_IngredientList_Eng_v5.indd Add to Reading List Source URL: www.kfc.ca Language: English - Date: 2014-10-21 14:02:00 Staple foods Starch Sodium compounds Caramel color Anticaking agent NOS Flour Monosodium glutamate Modified starch Food and drink Food additives Glutamates
67	Numbers & Oddities a.k.a. The Spooks Newsletter Edition #192, September 2013 Editor: Ary Boender email: Check for previous newsletters, info, sound samples and databases also: Add to Reading List Source URL: www.numbersoddities.nl Language: English - Date: 2013-10-05 03:18:16 Letter beacon Food and drink Glutamates Monosodium glutamate
68	PDF Document Add to Reading List Source URL: www.gns.cri.nz Language: English - Date: 2010-08-26 01:22:38 Nathan Stickman Monosodium glutamate Lumber Stiffness Invasiveness of surgical procedures Medicine Food and drink Structural analysis
69	PDF Document Add to Reading List Source URL: www.powerofmushrooms.com.au Language: English - Date: 2014-08-06 04:09:47 Gustation Sodium compounds Gustatory system Umami Monosodium glutamate Glutamic acid Taste Flavour enhancer Flavor Food and drink Food additives Glutamates
70	Response to Dr. Roger�s letter: further studies are necessary in order to conclude a causal association between the consumption of monosodium L-glutamate (MSG) and the prevalence of metabolic syndrome in the rural Thai Add to Reading List Source URL: www.nutritionandmetabolism.com Language: English Glutamates Food additives Sodium compounds Monosodium glutamate Nutrition Health sciences Glutamic acid Metabolic syndrome MSG Food and drink Health Chemistry

UPDATE