Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA

First Page		Document Content
Transcription factors SDHA Succinate dehydrogenase IRF3 Glutamate dehydrogenase 1 Interferon regulatory factors Glutamic acid Dehydrogenase CD36 Chemistry Biology Biochemistry		Table S2 The qPCR primers used for verification of the differentially expressed genes of the AA broiler hepatic tissues Gene name Primer sequence Product length（bp） β-actin forward: GAGAAATTGTGCGTGACATCA Add to Reading List Source URL: proteomesci.com Download Document from Source Website File Size: 22,84 KB Share Document on Facebook

	PROTOCOL Universal protein-binding microarrays for the comprehensive characterization of the DNA-binding specificities of transcription factors Michael F Berger1,2 & Martha L Bulyk1–4 DocID: 1vjhs - View Document
	Cell Reports Article Genomic Regions Flanking E-Box Binding Sites Influence DNA Binding Specificity of bHLH Transcription Factors through DNA Shape DocID: 1v9dp - View Document
	Integrated network analysis reveals distinct regulatory roles of transcription factors and microRNAs DocID: 1v92T - View Document
	A Pathway Switch Directs BAFF Signaling to Distinct NFκB Transcription Factors in Maturing and Proliferating B Cells DocID: 1uZXW - View Document
	DNA-binding speciﬁcity changes in the evolution of forkhead transcription factors So Nakagawaa,b,1,2, Stephen S. Gisselbrechtc,1, Julia M. Rogersc,d,1, Daniel L. Hartla,3, and Martha L. Bulykc,d,e,3 a Department of Org DocID: 1uQTK - View Document